Announcement

Collapse
No announcement yet.

HG19 position of BY18067 (under R-U106)

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • HG19 position of BY18067 (under R-U106)

    Hi Forum!

    I am helping a tester who did BigY and ended up in haplogroup BY18067 (under R-U106 L48). This haplogroup is only found on the FTDNA haplotree and nowhere else.
    How do I find out the hg19 position of BY18067 as well as its ancestral and derived mutation?

    Thanks!
    Anders

  • #2
    The FTDNA named "BY" series SNPs are added to http://ybrowse.org/gb2/gbrowse/chrY/? . How fast the addition of new names occurs varies but they do end up in that system.

    Comment


    • #3
      Originally posted by A.Morup View Post
      Hi Forum! I am helping a tester who did BigY and ended up in haplogroup BY18067 (under R-U106 L48). This haplogroup is only found on the FTDNA haplotree and nowhere else.
      How do I find out the hg19 position of BY18067 as well as its ancestral and derived mutation?
      Thanks!
      Anders
      Have the results sent to YFull. They will provide the information. For example, for Y18209 they give:

      Search in BAM file
      ChrY position: 2902857 (+strand)
      Reads: 64
      Position data: 63C 1G
      Weight for C: 0.984453781513
      Weight for G: 0.0155462184874
      Probability of error: 0.0219856730285 (0<->1)
      Sample allele: C
      Reference (hg19) allele: G
      Known SNPs at this position: Y18210 (G->C) Rating for known SNP
      Reference sequence (100bp): CCTCCTGGCTCCTGGTGGGTCCGGAGATGCCACGCAGGAGCCAGGGACTG
      G
      AGTAAGAAAGCTTACATGCCAACCTTGCATTCTCCTCTACTGTAGCTGAA
      (2902806-2902907)

      Comment


      • #4
        Thanks for your help!

        It turned out that FTDNA was just a bit late on registering at Ybrowse.org.
        The correct position is 7102793.

        Thanks!
        Anders

        Comment

        Working...
        X