
No announcement yet.

no mutations

  • Filter
  • Time
  • Show
Clear All
new posts
    Registered User

  • Eki
    Originally posted by louiseshappy
    Hi my name is Louise B. Shappy (maiden name is Martin). I had my mtDNA test done through GeneTree testing center, on 10/8/2004.Name of test I had ,native american maternal lineage analysis , my sequences do not match native american mtDNA database. My sequence for me (nucleotide positions 16001-16383): ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGT ACCACCC
    GAATATTGTACGGTACCATA......a segment of 383 base pairs of DNA in the mitochondrial genome, , "Hypervariable Segment I " was sequenced. This sequence was then systematically compared to a database of HVSI sequences of individuals with ancestry native to north America. The results of this comparison identify thoes sequences that match exactly or are one mutation step away from my HVSI sequence.. This sequence is then compared the CSR.
    By comparing my sequences to the CRS we can idenify the lineage to which I belone.. Louise, thank you please e-mail me at ,[email protected]
    Before I read your message, I thought your username came from "Louise's happy". Well, it didn't, but I hope you're happy anyway

    Leave a comment:

  • Guest

  • louiseshappy
    Guest started a topic no mutations

    no mutations

    Hi my name is Louise B. Shappy (maiden name is Martin). I had my mtDNA test done through GeneTree testing center, on 10/8/2004.Name of test I had ,native american maternal lineage analysis , my sequences do not match native american mtDNA database. My sequence for me (nucleotide positions 16001-16383): ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGT ACCACCC
    GAATATTGTACGGTACCATA......a segment of 383 base pairs of DNA in the mitochondrial genome, , "Hypervariable Segment I " was sequenced. This sequence was then systematically compared to a database of HVSI sequences of individuals with ancestry native to north America. The results of this comparison identify thoes sequences that match exactly or are one mutation step away from my HVSI sequence.. This sequence is then compared the CSR.
    By comparing my sequences to the CRS we can idenify the lineage to which I belone.. Louise, thank you please e-mail me at ,[email protected]