Probably a stupid question about ydna H subclades

[rdbox26hs]

I just got my Geno 2.0 kit results yesterday and uploaded them to ftdna. Ftdna is still showing me as H1a/H-m82, but Geno 2.0 now has me as H1/H-m52.

I knew there was some relayering in R1b and J2, but how should I understand these new H results.

[tomcat]

I think that is a question best directed to FTDNA or your Y project admin.

Geno tests many more Y SNP's than FTDNA's Deep Clade, so Geno may be more accurate. The discrepancy also could arise if FTDNA and Geno are referencing different builds of the Y tree.

Is m82 downstream of m52?

[MMaddi]

According to ISOGG's tree for H - at http://www.isogg.org/tree/ISOGG_HapgrpH.html - M82 is downstream from M52. So, FTDNA's designation of H1a is deeper than Geno 2.0's H1.

It's possible that M82 is not included on the Geno 2.0 chip, so they didn't test you for that. You can check your raw data and see if M82 is on the chip or not.

[ScooterCat]

M82 is tested in Geno 2.0. Possibly a no call?

[MMaddi]

M82 is tested in Geno 2.0. Possibly a no call?

I think a no call would be indicated by "-." What does your raw data file have as the result for M82?

[rdbox26hs]

I think a no call would be indicated by "-." What does your raw data file have as the result for M82?

The Raw Data File, CSV, has me at M82 as D, both in Allele 1 & 2.

FTDNA in SNPs says I am m82+.

I have not found any information online about the re-layering of y-dna H, unlike several other Haplogroups. This is basically what is confusing me about my terminal SNP.

[MMaddi]

The Raw Data File, CSV, has me at M82 as D, both in Allele 1 & 2.

FTDNA in SNPs says I am m82+.

I have not found any information online about the re-layering of y-dna H, unlike several other Haplogroups. This is basically what is confusing me about my terminal SNP.

I would trust FTDNA's call for M82 over Geno 2.0's call. FTDNA uses direct sequencing in their SNP testing and Geno 2.0 uses chip technology. Direct sequencing is regarded as more accurate.

[ScooterCat]

The Raw Data File, CSV, has me at M82 as D, both in Allele 1 & 2.

FTDNA in SNPs says I am m82+.
...

D (delete) is the derived form, so Geno 2.0 is showing you as M82+ also, and should be showing your haplogroup as H1a.

From ymap:
ChrY M snp 20353562 20353562 . + . ID=M82;
allele_anc=ins;
allele_der=del;
primer_f=CTGTACTCCTGGGTAGCCTGT;
primer_r=AAGAACGATTGAACACACTAACTC;
YCC_haplogroup=H1a;
ISOGG_haplogroup=H1a;
Mutation=-2bp;
count_tested=656;
count_derived=53;
comments=B9.t18

[Donald Locke]

rdbox26hs, I presume you are a participant in the Y Haplo H project?

If you are who I think you are, FTDNA shows you in Y Haplo Group H1a - M82, and if you are the right participant that I am looking at, you have also been Deep Clade SNP tested with FTDNA and confirmed H1a, is that correct?

If that is the case that you have been Y DNA tested to the 67 marker level and also been Deep Clade SNP tested H1a - M82, then the Geno 2.0 isn't up to speed on Haplo H* if it is only showing you in H1.

I had hoped the Geno 2.0 test would dig deeper in to us H* men, but it seems FTDNA is more on the ball then Geno 2 when it comes to the H* men.

[Donald Locke]

According to one Indian / Romany DNA study published recently, that team has identified a deeper downstream of H*, which they identifiy that downstream SNP as H1a1a, and I had high hopes the Geno 2 test would be able to identify anyone in the downstream SNP, but if Geno 2 is only telling you H1 then it appears Geno 2 isn't looking at the H* downstream SNP's yet.

[rdbox26hs]

rdbox26hs, I presume you are a participant in the Y Haplo H project?

If you are who I think you are, FTDNA shows you in Y Haplo Group H1a - M82, and if you are the right participant that I am looking at, you have also been Deep Clade SNP tested with FTDNA and confirmed H1a, is that correct?

If that is the case that you have been Y DNA tested to the 67 marker level and also been Deep Clade SNP tested H1a - M82, then the Geno 2.0 isn't up to speed on Haplo H* if it is only showing you in H1.

I had hoped the Geno 2.0 test would dig deeper in to us H* men, but it seems FTDNA is more on the ball then Geno 2 when it comes to the H* men.

That is correct. For some reason, though, in the project I am now merely m69.

I too was hoping for some higher resolutions on Haplogroup H. For one thing my familial origins don't really fall into the typical Haplogroup H pattern, and I was hoping to find out at what point my paternal family line wound up where it was.

[Donald Locke]

I am going to order the Geno 2.0 test myself one day in the near future just to see what it has to tell me.

I just logged in to the project as Admin and I see you are listed as M82 not M69. I am not sure where you are seeing it listing you as M69?
Regardless what Geno 2 has to say, you have been Deep Clade SNP tested with FTDNA and FTDNA says you are M82 - H1a.

If it were me I think I would be addressing that issue directly with Genographic and explain to them that you have been Deep Clade SNP tested M82 - H1a, why then is Geno 2 reporting you as M69 just to see what they have to say about it.

[Donald Locke]

Looking at your Geno 2 results.
Geno did test you positive for M82+ - H1a, but also shows you negative for M36- H1a1

So they did in fact test you positive for M82+ even if the report you are looking at shows you in M69 - H.
That maybe a bug on their end if Geno is showing you in M69 when you did in fact test positive for M82+ = H1a which agrees with what FTDNA reported on your Deep Clade SNP test.

Geno 2.0 did look at M36 = H1a1, did look at M97 = H1a2 both of which you were negative for. So I am satisfied that even if there maybe a little reporting bug, they did dig deeper and did look at those sub groups which you were negative for both which places you as a good positive M82+ = H1a man.

[Donald Locke]

And because you tested positive for M82 and were negative for M36 = H1a1 and negative for M97 = H1a2, is likely why Geno 2 did not test apt = H2.

FTDNA's Deep Clade does test apt = H2 even though Geno 2 does not appear to be testing for that, likely because you tested negative for M36 and negative for M97.

That does ease my mind a bit though, now knowing Geno 2 is in fact testing for M36 and M97, both of which appear to be quite rare. To date I know of no H* participant testing positive for M36 or M97, but as more H men order the Geno 2 test that could change very quickly. And I have never seen a positive apt = H2 result either.

[rdbox26hs]

I noticed that I cannot see the haplotree anymore, and that not all my y-snps show up in FTDNA. There are lots more of them in my Geno 2.0 raw file.

Could the tree be relayered? Dienekes mentioned something about this with F and subclades, and I know it has happened with R, J and I.