Haplogroup T mystery

[Cazola]

My recent ancestors on both sides of the family are purely from the mediterranean island of Malta however I have been identified from the Genographic project as being from Haplogroup T (mtdna). This group arose 10,000 years ago and today are most commonly found in the Ural Mountains and the Western Baltics of Eurasia.

This is a huge surprise as I would have expected to have a haplogroup connected more toward southern Europe - not Russia !

Does this mean I have Russian ancestry somewhere ? Does anyone have any theories on Hapologroup T ??? Please help !

[T E Peterman]

Find out if your line is T*, or T1, or T2. Bryan Sykes, author of the "Seven Daughters of Eve" speculates that the common ancestress of T (nicknamed Tara) lived in Italy during the last Ice Age & spread out from there. My branch (T1) appears to have originated in what is now Bulgaria or Turkey, perhaps in a pre-flood Black Sea community. After the inundation of the Black Sea area (ca. 5400 BC), T1 scattered, leaving a starburst pattern in distribution, centered on the south or west bank of the Black Sea. My matriline was English. You will find T scattered all over Europe.

Timothy Peterman
Kansas City, MO

[[email protected]]

Please tell me which tests are necessary to get to the subclades (is that the correct word) of T. Thanks.

[Cazola]

My T grouping is T3

My specific T grouping is definitely T3 as confirmed by Familytreedna.

Any more info for me ?

[vraatyah]

>Does this mean I have Russian ancestry somewhere

definitely it doesn't

what's your hvs1 sequence? and hvs2, if any

[Cazola]

HVR1 info

The information is as follows:

HVR1 Haplogroup
T3

HVR1 differences from CRS
16126C

16146G

16147T

16292T

16294T

16296T

16519C


Do you have any info for me ?

[vraatyah]

I have only 2 sequences that match for both your transitions at 146 and 147:

one from Northern Egypt (I cannot remember the source)

126-146-147-292-294-296

and other from Eastern Jordan (Amman, published in Richards' Founder 2000 paper)

126-146-147-292-294-296-319

as for partial matches with G at 146, they are mostly from NE Europe except for several ones from Turkey and Arab countries between Mediterranea and Persian Gulf. All European sequences with 146 have additional change at 284 site which is also known in T1 background; some T5 sequences have 146, so neither 146 nor 284 is reliable. Further, i don't see any direct association between 146 and 147: Finnila's complete sequence with 146-284-292 is quite distant from Palanichami's one with 147 which lacks 292 and 297 (whereas most Ts with 147 have 297). Neither one with 147-297 has 292 so doesn't fall into Richards' T3 clade. I think, your type is not far off from Finnish ones and 147 is more likely to be a recent change. Both your sites 146 and 147 together is very reliable indicator of common ancestry i.e. those 2 sequences (Egyptian and Jordanian) belong to individuals who closely related to you.

Valery

[vraatyah]

returning to the sources: sorry, Jordanian sample is not from Dr Richards' paper, it's one of 146 sequences of Cabrera, unlike one from Egypt which is from Founder 2000.

[Cazola]

T3 info

Valery - thanks for this excellent info - this seems to make sense.

Interestingly I have been to Jordan on a holiday and most people thought I was Jordanian in appearance !.

Could you please explain your statement below a bit more - especially the Finnish bit - I found that interesting.

"I think, your type is not far off from Finnish ones and 147 is more likely to be a recent change."

By the way - how is it that you know so much about this topic ?

Also - is the book Seven Daughters of Eve accurate in any way shape or form or is it now outdated ?

[vraatyah]

>is the book Seven Daughters of Eve accurate in any way shape or form or is it now outdated ?

unfortunately, I haven't read it but some claims cited seem very odd or at least outdated.

[dbeaver]

T*

My recent ancestors are African American. I was tested through the Genographic Project and found that I have T*. My results are as follows:
HVR1
1. 16126C
2. 16185T
3. 16189-
4. 16294T
5. 16296T
6. 16519C

I am not sure how to interpret the results. Another DNA testing show the same results but told me that, although there are no exact matches, I should look to the Romanian Jews, Nubians and Portugese for a clue to my maternal lineages. Any suggestions for where I should look for further information?

[vraatyah]

First of all, the alignment you used

crs
AAAACCCCCTCCCCATGCTT
your type
AAAACTCCC-CCCCATGCTT

is not the only one possible. Another one is

crs
AAAACCCCCTCCCCATGCTT
your type
AAAACTCCCCCCC-ATGCTT

ie 126-185-189-193d-294-296 and some authors follow this numbering.

Restricted to hvs1, your type exactly matches one from Austrian forensic dataset:

Caucasian of University of Innsbruck
126-185-189-193d-294-296
073-263-309.1C-315.1C-315.2C-315.3C
1 of 101

among more more distant matches I'd like to list

Russians Orel (Malyarchuk 2002)
126-185-294
073-152-263-309.1C-315.1C
1 of 76

and

Caucasian of Armed Forces DNA Lab
126-153-185-189-193d-294-296
073-263-309.1C-315.1C-315.2C-315.3C
1 of 1244

The latter example suggest that one of the transitions at 153 and 185 is homoplasious. Exactly, this HVS1 is closely related to

Portugal Southern of Pereira
126-153-189-294-296
73-150-263-309.1C-315.1C

which falls into T5, and the forensic one is T5 too. Although the transition at 16185 is not of weighty ones, it's relatively unusual in T background and I wouldn't like to exclude that your sequence falls into T5 rather than T*.

Valery

[vraatyah]

>My recent ancestors are African American. I

sorry, I went into phylogenetical details. This means that your direct ancestor on maternal line was caucasian, more likely european. Did i answer your question?

[dbeaver]

Haplogroup T Mystery

Yes. I think you did answer my question, but let me rephrase your answer so I will know I got it right. This would mean that maternal line is caucasian, but would it only be my mother's maternal line that was caucasian and not necessarily my mother's paternal line?

[vraatyah]

only mother's mother's mother's ....... mother and so on