dna results

[sundodger]

So if my Mum is O+ she got two O's from each parent? Looking on that map her Mum could easily have been O as it's still high in Western Europe (maternal side is British)...but then her father could have been of European descent also in theory? Were both parents O+ to get an O+ child?
And how would you find out about Diego blood?

For a child to be type O, she would have to get one O gene from each parent. Therefore, each parent must be either AO, BO, or OO. An AO parent would have type A blood, a BO parent would have type B blood, and an OO parent would have type O blood. For a child to be Rh+, at least one parent must be Rh+.

People of European ancestry aren't tested for the Diego factor because it is only found in East Asians and Native Americans. If you are really curious, you can probably find a haematologist who will test you for it.

[Maria_W]

DNA and blood types.

So very interesting that 79% of Native Americans were Type O. Type O being 63% of all blood types I beleive. My mother is O-(OO), I am O+(OO), I believe my father is A+(AO) Yes I know the - or + is the rhesus factor. Something to do with rhesus monkeys. My mother had a very high chance of miscarriage becasue of this - Rhesus factor. All of us children were born premature. Since I am only 10% American Indian DNA wise I probably would be a negative diego, doesnt state how much you have to be to be positive. Have a nice day.

[Maria_W]

Whos responsible?

Since type O makes up 63% of all blood, yes it is pretty common. Highest rate is found in South and Central America where it approaches almost 100%, Australian Aborigines and Western Europe. Lowest in Eastern Europe and Central Asia. 10% Native American dna wise and also 90% European. My Native American Ancestry is Virginia Algonquian(Potowomeck). Both parents are. Still researchinfg other lines. My European ancestry is from Northern Europe 47%, Asian 23%, Middle Eastern 23% and Southeastern Europe 7%. Who knows where the Type O came from. Which group is responsible. Maybe both! Have a nice day.

[Sonia]

FBI Program

tomcat i put your mitosearch results in this mtdna population program i got from the FBI and it says this Hispanic 16024-16365 73-489 16223T 16298C 16325C 16327T 73G 249D 263G 290D 291D 309.1C 315.1C 489C only difference is no 16114T so your mtdna is most likely Hispanic and most Hispanic are native american

Hi msc,
I successfully downloaded the program, was able to put the range in & differences from Anderson (CRS), but when I try to run it, it doesn't seem to let me choose a file name. I went into the options & tried to choose the browser, word processing & spreadsheet sections, but that didn't help. Any ideas on what I'm doing wrong?

TIA,

[msc_44]

I successfully downloaded the program, was able to put the range in & differences from Anderson (CRS), but when I try to run it, it doesn't seem to let me choose a file name. I went into the options & tried to choose the browser, word processing & spreadsheet sections, but that didn't help. Any ideas on what I'm doing wrong?

hi i looked up you mtdna on the fbi program and it says you are
African-American

[Sonia]

Thanks!

hi i looked up you mtdna on the fbi program and it says you are
African-American

Thanks for the look up! If you come up with any ideas on how I can get it to save to a file, please let me know.

Sonia

[msc_44]

when it ask's for the file name just click the menu to the destop and put a name in the file name spot and click save that it

[louiseshappy]

mtDNA

hi i just got my results for my Y dna what does it mean what Haplogroup is it

DYS199C, M242C and RPS4Y711C alleles


and here is the mtdna what does it mean

MtDNA sequence for Carlile (Nucleotide positions 16001-16383):
ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGT ACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACA TTACTGCCAGCCACCATGAATATTGTAGTACCATAAATACTTGACCACCT GTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACA AGCAAGTACAGCAATCAACCCCCAACTATCACACATCAACTGCAACTCCA AAGCCCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGT ACATAGCACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCC CTTCTCGTCCCCATGGATGACCCCCCTCA
Method of Testing and Analysis:
A segment of 383 base pairs of DNA in the mitochondrial genome, referred to as the “Hypervariable Segment I” or HVSI, was sequenced. This sequence was then systematically compared to a database of HVSI sequences of individuals with ancestry native to North America. The results of this comparison identify those sequences that match exactly or are one mutation step away from your HVSI sequence. This sequence is also compared to the Cambridge Reference Sequence or CRS. The CRS was the first human mitochondrial genome published in 1981. By comparing your sequence to the CRS we can identify the name of the lineage to which you belong. These lineages are also called haplogroups. Many haplogroups are continent specific and subdivisions of these haplogroups are often regional specific.
Summary and Interpretation of Results:
The HVSI sequence for Carlile contains two differences from CRS. The positions where Carlile’s DNA is different from CRS are called nucleotide positions and there are approximately 16569 nucleotide positions (np) in the mitochondrial genome. Carlile’s differences occur at np 16224 and np 16311.

HI,MY mtDNA was sequenced,(np 16001-16383): no mutations, i,m not sure what this all means.if you know anything about this e-mail me,
[email protected]

[taba2much]

diego

I have AB+ blood type, how do I find out if I have the diego dang what test does that and what does AB+ blood type have too do with Native/latin American??????????? Im interested in that diego, never heard of it before, how do I get tested????

[Maria_W]

Type AB blood, rare in Natives.

The Diego antigen is only found in Native Americans and Asian, so if you feel that you are Native American or Asian I would go to your doctor and ask for a blood typing test. Don't be surprised if your doctor looks at you really funny. Most haven't even heard of it. Less than 1% Native Americans have type AB blood, so AB is pretty rare. By the way I have sent you several private messages and not sure if you have recieved them . You asked me to help you figure out your dna tribes files. Maria