Announcement

Collapse
No announcement yet.

dna results

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • dna results

    hi i just got my results for my Y dna what does it mean what Haplogroup is it

    DYS199C, M242C and RPS4Y711C alleles


    and here is the mtdna what does it mean

    MtDNA sequence for Carlile (Nucleotide positions 16001-16383):
    ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGT ACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACA TTACTGCCAGCCACCATGAATATTGTAGTACCATAAATACTTGACCACCT GTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACA AGCAAGTACAGCAATCAACCCCCAACTATCACACATCAACTGCAACTCCA AAGCCCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGT ACATAGCACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCC CTTCTCGTCCCCATGGATGACCCCCCTCA
    Method of Testing and Analysis:
    A segment of 383 base pairs of DNA in the mitochondrial genome, referred to as the “Hypervariable Segment I” or HVSI, was sequenced. This sequence was then systematically compared to a database of HVSI sequences of individuals with ancestry native to North America. The results of this comparison identify those sequences that match exactly or are one mutation step away from your HVSI sequence. This sequence is also compared to the Cambridge Reference Sequence or CRS. The CRS was the first human mitochondrial genome published in 1981. By comparing your sequence to the CRS we can identify the name of the lineage to which you belong. These lineages are also called haplogroups. Many haplogroups are continent specific and subdivisions of these haplogroups are often regional specific.
    Summary and Interpretation of Results:
    The HVSI sequence for Carlile contains two differences from CRS. The positions where Carlile’s DNA is different from CRS are called nucleotide positions and there are approximately 16569 nucleotide positions (np) in the mitochondrial genome. Carlile’s differences occur at np 16224 and np 16311.

  • #2
    Originally posted by msc_44
    hi i just got my results for my Y dna what does it mean what Haplogroup is it

    DYS199C, M242C and RPS4Y711C alleles
    It appears that the testing company was specifically looking for Native American ancestry. This says that DYS199-T is indicative of Native American ancestry:

    http://www.pubmedcentral.gov/article...gi?artid=26878

    Similarly, M242-T can be Native American:

    http://www.pubmedcentral.nih.gov/art...?artid=1180698

    And also RPS4Y-T:

    http://www.ncbi.nlm.nih.gov/entrez/q..._uids=10738521

    The fact that you have C instead of T for all of these simply indicates you are not Native American.

    Comment


    • #3
      Originally posted by msc_44
      Carlile’s differences occur at np 16224 and np 16311.
      The mtDNA mutations 16224C and 16311C indicate membership in mtDNA haplogroup K, I think.

      Comment


      • #4
        Originally posted by lgmayka
        The mtDNA mutations 16224C and 16311C indicate membership in mtDNA haplogroup K, I think.
        At first glance, your mtDNA results point to European matrilineal ancestry.

        Comment


        • #5
          Originally posted by lgmayka
          The mtDNA mutations 16224C and 16311C indicate membership in mtDNA haplogroup K, I think.
          Yes, 16224C and 16311C are the defining mutations for mHg K. Also, it is rather rare for a K to not also have 16519C.

          Comment


          • #6
            dna results

            my Y dna what does it mean what Haplogroup is it

            DYS199C, M242C and RPS4Y711C alleles

            This is what i found so far

            What ethnicity do these genes represent?
            Question

            Could you please tell me what ethnicity the following, DYS199C, M242C, RPS4Y711C, represents? This is something of great interest to me.
            Answer

            This is a rather interesting question. In checking for the "ethnicity" of specific genes, the search for the ethnicity of M242C was identified as a gene found in plants/trees in the Columbia River Basin sites where various bees habituate. Specifically, the, M242Ce denotes Engelmann Spruce while M242Cg gene denotes Interior Ponderosa Pine. Further information concerning this gene can be found at the following website:

            http://www.icbemp.gov/science/tepedino.pdf

            The gene RPS4Y711C is identified with males having Y-chromosomal haplotypes and can be found in Polynesia and other populations from Melanesia, Asia and Australia. Further information concerning this gene can be found at:

            http://www.eva.mpg.de/genetics/pdf/K...rBiol_2000.pdf

            The gene DYS199C is identified as being found with high frequency on the Y-chromosomes of Native Americans.

            So what i have found is that this is native american and the dna company refuses to claim it as indian i looked it up and these only come from oregon and washington on the east cascade mountains but what Haplogroup is it.

            Comment


            • #7
              dna results

              hi i posted the wrong results for the mtdna here is the correct one and after i blasted all of the snp's i got these results

              Amerindian(MAYAN)
              CENTRAL AFRICAN REPUBLIC
              Amerindian(MAYAN)
              Amerindian(MAYAN)
              NIGERIA(Ibadan)
              CENTRAL AFRICAN REPUBLIC
              SOUTH WESTERN NATIVE AMERICANS
              GERMANY
              SOUTH WESTERN NATIVE AMERICANS
              NIGERIA(Ibadan)

              Number 1113 rs1800498 TACTGTCTGCATTCTAAGATATAAGCATCaagtgtttggaacagtgcctg acacatggtaagtccttagtattattacagttattaGGACTTAGCTGAGC CAGCTCAGGGCCTGTACTGCAGGTCTCAGCTTTATGTGAGCAAGAGCATT AAGGAATGATGCCTGGATGCCTGGGGGTGTGAAGAAAAGAGCCTTGGGTT[C/T]GACTAGGGAACCTGGGGCCACTCCTTCCTCTGCTACTAAATCACCAAGTG ATCTTGTTCTGTTTTCTTCTCTGACCCTCCCTAGTTTTGTCCACCCTTGA AATAATCATCTTTCCTTTTCACATTTCATGCTTACCAAGTACTTGTCACC TAATTATCTCCTCTCTTGATAAGCTAGATGGTYCCTTCCAGGGCAGCTTA

              Number 1116 rs3340 GGTGGAGAGCACTTAAAAACAAAATGAATGATCAATATGAGGGGCCAAAG TCCTTCATTCTTTTTCAAAACATTCCTCAAAACCTTTTTTTTTTTTTTTT TGGTGAAAACCACTTAGAAATCGAATACGTCCATTTCTTTGTAAAATAAC AATAACGTT[G/A]AAGGCAAAAGCAAGATTCTGTAAACCAACATTGGAAAAGGGGACACAGGG AGGGGCAGAGGGAAAGGGCCAGATTTTCAACGGTTTCCTCCACATCTGCA GACAAAGGCCCGCCTACTCT

              Number 1121 rs2065160
              TGCAGTACTGTGACCGCTGCTGTGCTAGCTGCTGATCAAAGAATTACACA GACATTTATAGTCTAAGACAGGCATGAGAACATCTGAAAACACATTGTAA AGAATGGCCTCTCGATGAGTAAATATGGG[C/T]CAAATGAAGTAAACAGACTATGCGTAGGTATCATCAAATATAGAGAGAAT GAACAGACCGAAGAAGGGAAATACAAAGAGGTTTGACGTCCTCACAGCCT AAAAACTAGTGTCTGTTTCCCTTCTTGAAATGGACATTACTTGGCTAGAA TTATTTCCTGGAGAAATAAACATATTAGACAGAAATAACCATGCTGGCTA TTGAAATATAGCCAATGAAAATATTTGTCTTCACGTAGCA

              Number 1122 rs285
              CCTGCAAGGGTTTTGCTTAATTCTCAATTCAATGTCTCTTCATCTTTTAG[T/C]AGCTGTGGGGTTTTGTTGTTGTTCTTCTGTTTTTGCTTAGTATCTGACTA

              Number 1128 rs594689 CTCCGAGGTGATGGTCATGTAGCGGTGCACAATGGATGAAGGCTGCTCTC GACATAGAGGGTTGGAGGCCGGGCAGAGACAGCGGCTAGAGACCCCGAGG TGGGGGACACAAATGA[A/G]CTCCTTGCCCGTCCCCCCAATTTCTCCTACCCTACAAAGGGAGGGAATCC CAAAAGGACCCTTCTACCCCTGTGACTGGTTTTCATGAAGGACTATGATT CCCATCATCCCTCAGGGGCACTCGCTGGTCTGAATAGATGCCAGTCAGCC CCAAAGCCCCCTGGGAGACGTAGTTTCTGTGGGGGCCTGGCATCGAATTG ACTCACTTCTCAGAGACCTGGATGTAGGGCTCCACGCAGCGGTTGGTGTC CACGCAGCGGTAGCCCCCATGGAAGTTGACACAGGTTTGGGCCTCGGAGC ACTGGTGCGCACCAGACTCACACTCATCAATGTCTGTGCCAGGGGAGAGG GGCTGGAATCGGGGGCGTCAGGCTGCCAGCTCCTGACACCGTCCTGCCCA TCCCACCCGGGCAACCTGTACCTTGGCAGAGGCGTGTGGCCAGCA

              Number 1136 rs3287
              AACTAGTTACCAGCAGTAAGTTTCCCATTCTATCAATAAACAATGCAAGA GAGAAGATTTTGGAGATTTTTTTTTTTTTTTGGTTAAAGTGTGAGAATAT GAATACACTTGGATTATAATCCATCCTCCAACACACACACAAATAAGCAG CTAATGGCAAT[A/G]CTAGTGGTCTTCCCAATTCACAAGACCTGTGCTTCAAATTGTTTTCCTGA TAATGTGGAGAAATGTGCTCTTTATGTATTCTCAAGAAACAGGATGTGAA AAGCTGGTATGGGTATACAAGATAAAAATGCCTACCCAGAGTGGGCAGAA GCCTCTAAATATTACTGGTTTGCTAAAAGTTTCAGATGCT

              Number 1138 rs2695 TCTCATTCTTAGCTCTCCATAAAGCAAGGGGTATAGTAAATGGCTTTTTT TTGTTGTTTTTTGCAGTTCTCTGAAAGACAATGGATTGTGGAGCATACTG AAGACTATTCCTAAATGGCTATTTGTGTTGGGTGGTCAAG[A/G]CTATTCAGAAAATCTCAGAGGAGGACAAATGAtagtgcactgcagccagc tcggactggcttgcaagagtcagttattcatttttcaggaattccatgtt gttaaatgcagacattattaaaatttaaattacataaacacactctgaaa taaattatgttacatacaaactcatcagtt

              Number 1139 rs6003 TTATGCAGATATTTCCAAAATGAAATCGCCAATAATAACATTATACTTTT GGCTTAATTTTACAATTTAGTAAAAGACAAGCTTAGTTTCATCATTAAGT TAAATAATTTTTTTTCCCATAGAAAAATGCACTAAGCCTGACCTGAGTAA TGGTTACATCTCTGATGTAAAGTTATTGTATAAAATTCAAGAGAACATGC[A/G]TTATGGTTGCGCTTCAGGGTACAAAACCACTGGAGGGAAGGATGAAGAAG TGGTTCAATGTCTCTCTGATGGATGGTCTTCTCAACCAACCTGTAGGAAA GAACATGGTATAAGAATCATTTCCTAAACTGAAGATAAGTGCTTATCAAG CTTATATTGAATATATTGAAGCTTATATTGATATCTATTATTTAATAGAA

              Number 1141 rs3317 ACAAGCCATGTGAGGAATAGAGTTAATAAAGAGCAGTGTTCATGGCTCAT TTATCTGTATTTACTTAAAACTTTCCTTAAATAATTCTGGGTTAGGAAAA AAGCCCCACAAAATAAAATGAAATATAACAGTTAAATGAGAACTCAATTT TATTTACATCTATTTATTTCCATTCAGTGTATCACATCTTCAGGATAGGT[G/A]ATAACAGTGTGAAGGGTGTGCTCATTTTCTTCAGCTGTGAGTAGAGGAGT CTTCCCGAGAGTAGCAGTTGTGATCCAAATGATTGAAGCCTTCAGGTAAG GGAATAACTGCTGCAGGAATTCTTTCTTGAAGAATTTAAGCTGTTTGGTA GGAATTCTGTAACTACATACCTTTGAAACACTATTCACATTCAAATAAAC

              Comment


              • #8
                All these rs-prefixed SNP's are from the seq.pdf of a DNAPrint AncestryByDNA report. From yours it would seem that you are, autosomally and to some degree Native American but that inheritance does flow from either your direct paternal or direct maternal lines as evidenced by your y- and mt-DNA haplogroup designations.

                Tom

                Comment


                • #9
                  Hi,
                  Sorry if I seem a thick here but are those snp's from your AncestrybyDNA report and if so, Tomcat how did you know what ethnicity they show?
                  Is there some kind of pattern to look for?
                  Thanks.

                  Comment


                  • #10
                    Correction

                    ... you are, autosomally and to some degree Native American but that inheritance DOES NOT FLOW from either your direct paternal or direct maternal lines as evidenced by your y- and mt-DNA haplogroup designations NEITHER OF WHICH ARE NATIVE AMERICAN.

                    Tom

                    Comment


                    • #11
                      Originally posted by msc_44
                      hi i posted the wrong results for the mtdna here is the correct one and after i blasted all of the snp's i got these results

                      Amerindian(MAYAN)
                      CENTRAL AFRICAN REPUBLIC
                      Amerindian(MAYAN)
                      Amerindian(MAYAN)
                      NIGERIA(Ibadan)
                      CENTRAL AFRICAN REPUBLIC
                      SOUTH WESTERN NATIVE AMERICANS
                      GERMANY
                      SOUTH WESTERN NATIVE AMERICANS
                      NIGERIA(Ibadan)

                      Number 1113 rs1800498 TACTGTCTGCATTCTAAGATATAAGCATCaagtgtttggaacagtgcctg acacatggtaagtccttagtattattacagttattaGGACTTAGCTGAGC CAGCTCAGGGCCTGTACTGCAGGTCTCAGCTTTATGTGAGCAAGAGCATT AAGGAATGATGCCTGGATGCCTGGGGGTGTGAAGAAAAGAGCCTTGGGTT[C/T]GACTAGGGAACCTGGGGCCACTCCTTCCTCTGCTACTAAATCACCAAGTG ATCTTGTTCTGTTTTCTTCTCTGACCCTCCCTAGTTTTGTCCACCCTTGA AATAATCATCTTTCCTTTTCACATTTCATGCTTACCAAGTACTTGTCACC TAATTATCTCCTCTCTTGATAAGCTAGATGGTYCCTTCCAGGGCAGCTTA

                      msc_44:

                      i'm just interested what kind of test did you take and does it have anything to do with the tests here people are talking about? And what kind of help do you need?

                      The first contig (Number 1113) seems to be perfectly alignable with a chunk of human DRD2 gene. The second one points to the chromosome 5. And so on. You testing company should provide you with the info on these autosomal markers, first of all - what they may tell you about your ancestry.

                      As to your HVS1 variant, which is 128d-130d-224-257d-258d-311, obviously it fits the haplogroup K definition, except for 4 bases you lost during the copy-paste manipulations.
                      Last edited by vraatyah; 6 August 2006, 04:44 PM.

                      Comment


                      • #12
                        dna results

                        if you dont believe me blast them your self

                        http://www.ncbi.nlm.nih.gov/SNP/

                        here is the results you get

                        Amerindian(MAYAN)
                        CENTRAL AFRICAN REPUBLIC
                        Amerindian(MAYAN)
                        Amerindian(MAYAN)
                        NIGERIA(Ibadan)
                        CENTRAL AFRICAN REPUBLIC
                        SOUTH WESTERN NATIVE AMERICANS
                        GERMANY
                        SOUTH WESTERN NATIVE AMERICANS
                        NIGERIA(Ibadan)

                        I took this test Combo Y/mtDNA/AncestryByDNA Test

                        Comment


                        • #13
                          Originally posted by msc_44
                          if you dont believe me blast them your self

                          http://www.ncbi.nlm.nih.gov/SNP/

                          here is the results you get

                          Amerindian(MAYAN)
                          CENTRAL AFRICAN REPUBLIC
                          Amerindian(MAYAN)
                          Amerindian(MAYAN)
                          NIGERIA(Ibadan)
                          CENTRAL AFRICAN REPUBLIC
                          SOUTH WESTERN NATIVE AMERICANS
                          GERMANY
                          SOUTH WESTERN NATIVE AMERICANS
                          NIGERIA(Ibadan)

                          I took this test Combo Y/mtDNA/AncestryByDNA Test
                          Just had a look on that website...I put scores in and got similar things to you above with various numbers 88 here, 40 there etc. what do they mean and what are the little coloured bars on the right?
                          Sorry to appear so stupid!

                          Comment


                          • #14
                            Originally posted by burto
                            Hi,
                            Sorry if I seem a thick here but are those snp's from your AncestrybyDNA report and if so, Tomcat how did you know what ethnicity they show?
                            Is there some kind of pattern to look for?
                            Thanks.
                            I know they are from an ABDNA report because I took an ABDNA test last year. My response to MSC_44 was predicated on the BLAST search results MSC_44 posted at 3:10pm that included -

                            Amerindian(MAYAN)
                            CENTRAL AFRICAN REPUBLIC
                            Amerindian(MAYAN)
                            Amerindian(MAYAN)
                            NIGERIA(Ibadan)
                            CENTRAL AFRICAN REPUBLIC
                            SOUTH WESTERN NATIVE AMERICANS
                            GERMANY
                            SOUTH WESTERN NATIVE AMERICANS
                            NIGERIA(Ibadan)

                            The list above seems to indicate that MSC_44 found support via that BLAST search for Native American ancestry - a conclusion not supported by MSC_44's y- and mt-DNA results.

                            And that is all! I don't know how to do what ABDNA purports to do. But anyone with an ABDNA report can research the public-domain SNP's contained in the seq.pdf of their report and is free to reach their own conclusions.

                            Tom

                            Comment


                            • #15
                              For example just put one sequence in and got this:
                              Nigeria 94
                              European American 103
                              African American 95
                              Mexican American 86
                              East Asian 80
                              Amerindian (mayan) 72
                              Mayan 96
                              What's that mean?! Am I to presume that sequence is most likely to be European American as it is the highest score? Have emailed them and asked but if anyone has any ideas let me know!
                              Alot of mine come out mostly as Nigerian, German, Spanish and Mayan! Did have an England too...yay!

                              Comment

                              Working...
                              X