Announcement

Collapse
No announcement yet.

Need some 101 explanations about mutation terminology

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Need some 101 explanations about mutation terminology

    Hi, can anyone give me a link to a good guide on how these haplogroup mutation terminologies work? For example, the famous M173, which only occurs in Y-dna haplogroups R1a and R1b, what does it mean EXACTLY? What part of the Y-dna strand is mutated. I'm supposing it's not base pair #173. How many mutations are there in this case? One, two, ten? From what to what did this/these base pairs change from/to? These are the sort of specific stuff I want to find out about. A guide detailing this in an exact manner.

    Also, if any of you wonderful people could be so kind, and you know the answer (! ! ), can someone tell me (approximately is good enough), how many of the 51,000,000 base pairs in the Y-dna chromosome are different in at least one haplogroup. [For example, if base pair #40,400,233 is the same value in all haplogroups except in one single haplotype (say for example I1a2) within one single haplogroup (in this case Hg I), then that base pair would be counted as different.]

    Let me push my luck a little more and ask the same thing (how many base pairs are different) but this time for all mtdna haplogroups.

    Thank you very much!!!!

  • #2
    It's a single substitution of an 'adenine' base to a 'guanine' base. The highliighted 'M' indicates where...

    M173 = DBY Ex08 (417 bp) A to C at position 191. Non-coding
    aagaaatgttgaactgaaagttgatGCCACTTTTCAGAAAAATGGTTGTG TTTTGTACAAAT
    TGAAATACATTGTTTAAAAATAAAGCACAGTACTCACTTTAGGTTTGCCA TATAAATT
    TACTGTAACTTCCTAGAAAATTGGAAATAAAGTAAGAAAAATTTTCTTAC AATTCAAG
    GGCATTTAGAACMCTTTGTCATCTGTTAATATTCAGAAATGATAAGCCAGTG
    TTTTGTTTTCAGGATCTGGGAAAACTGCAGCATTTCTTTTACCCATACTG AGTCAGA
    TATATACAGATGGTCCAGGAGAAGCTTTGAAGGCTGTGAAGGTAAAGGTT TTGTTATAAAATCAGACATTTTTGTTTTAAAAAGCTTTGCAAAGCCCTGT TGACTTTTCtaacggatgccagatacacct

    A single mutation, as above, defines one haplogroup from another. In the case of M173, it splits the human tree into R1 from the 'R*' haplogroup.

    Here's couple of sources Stanford University and University of Arizona

    You pushed your luck with the mtDNA question
    I've not tested the mtDNA so I've yet to familiarize myself with the nomenclature.

    Comment


    • #3
      Thanks for that. A link led me to this interesting page:

      http://www.mitomap.org/cgi-bin/mitomap/tbl8gen.pl

      It gives the nucleotide position within the mtdna at which a mutation has been confirmed to produce a certain disease. For example, changing nucleotide #3460 from G to A might be involved in LHON (Leber Hereditary Optic Neuropathy). It lists some 300 mutations that are perhaps linked to genetic disorders in mtdna, and the total diseases seem to be around 20.

      I'm guessing these are extraordinary mutations, and are not the same mutations that are widespread amongst the world population and that are used to identify the different mtdna haplotypes. Otherwise, some populations would have epidemics of certain types of genetic disorders! But then again, I'm not an expert on the subject. Can anyone help me? Are these 2 different sets of mutations?

      Also, is there some table here to consult where all the known mutations of all the mtdna haplotypes identified so far are listed? I found something similar for Y-dna haplotypes, with a very cool graph (though it seems slightly outdated, I think it's the university of Colorado ycc.com website, or something like that).

      Comment

      Working...
      X