DNA Letter Sequence

[GregR1]

Hi,

I have seen that our DNA sequence comes in the form of repeating letters. How can we see our sequence in our results?

Thanks

[GregR1]

Sequence letters

The letters are supposed to be RNA sequence of four letters that repeat. Does anyone here know about that?

[David Guetta]

It depends on what test you want to know about; for instance a Y-DNA STR test each STR is a repeat of certain letters and the number you see in the raw results is how many times that pattern of letters was repeated. If you look up the name of the STR, such as DYS391, you can see what letters make up that pattern.

[GregR1]

It depends on what test you want to know about; for instance a Y-DNA STR test each STR is a repeat of certain letters and the number you see in the raw results is how many times that pattern of letters was repeated. If you look up the name of the STR, such as DYS391, you can see what letters make up that pattern.

I know so little abut this stuff, that it can be hard to get across a question. Here is something from an article that is what I'm trying to get at:

Just for a moment after unrolling the piece of paper, I was struck speechless. Among the multicoloured lines, the computer-generated graphs and the maps was an innocuous string of letters, beginning, GCTTCTCGCG.

G, A, T and C, the four letters of the genetic code — representing the four bases that make up every strand of DNA - have become famous in the past decade. As scientists unlock the DNA codes of everything from bacteria to humans, the scale of the sequences - humans have 3bn pairs of these bases in their genome — can make them seem abstract. But, for me, seeing this sequence brought genetics into focus.

So, I'm trying to get to my particular string of letters: I understand that each string is unique.

[MMaddi]

I know so little abut this stuff, that it can be hard to get across a question. Here is something from an article that is what I'm trying to get at:



So, I'm trying to get to my particular string of letters: I understand that each string is unique.

As David Guetta responded, the answer to your question depends on which type of test you took. If you took one of the yDNA STR tests (12, 25, 37, 67 or 111 markers), you can look up the letters that make up the STR, which stands for "short tandem repeat." The number assigned to each marker is actually a count of the number of repeats of that specific letter combination.

For a SNP test, whether of yDNA or mitochondrial DNA, you are given one letter, since only one location in the DNA is being tested. For instance, the ancestral (negative) letter (also called nucleotide base) for the location of M269, defining a very common yDNA haplogroup, is T. If you are positive (derived) for that SNP, the letter/base is C.

For the Family Finder or other autosomal test, several hundred thousand locations on the 22 pairs of autosomal chromosomes and x chromosome(s) are tested. This is a small percentage of the 3 billion locations found in our DNA. When the same letters occur over a large enough segment of DNA on a chromosome when comparing two people, that's declared a match, meaning they received the segment of DNA from a common ancestor. In other words, they're related and that's proven by having so many locations in a row with the same letters.

However, I have to say that seeing the letters in your results would probably be boring and not very informative. It's only when the letters found in your results are compared to the letters known to appear in most humans at each location that they have any meaning.

[GregR1]

As David Guetta responded, the answer to your question depends on which type of test you took. If you took one of the yDNA STR tests (12, 25, 37, 67 or 111 markers), you can look up the letters that make up the STR, which stands for "short tandem repeat." The number assigned to each marker is actually a count of the number of repeats of that specific letter combination.

For a SNP test, whether of yDNA or mitochondrial DNA, you are given one letter, since only one location in the DNA is being tested. For instance, the ancestral (negative) letter (also called nucleotide base) for the location of M269, defining a very common yDNA haplogroup, is T. If you are positive (derived) for that SNP, the letter/base is C.

For the Family Finder or other autosomal test, several hundred thousand locations on the 22 pairs of autosomal chromosomes and x chromosome(s) are tested. This is a small percentage of the 3 billion locations found in our DNA. When the same letters occur over a large enough segment of DNA on a chromosome when comparing two people, that's declared a match, meaning they received the segment of DNA from a common ancestor. In other words, they're related and that's proven by having so many locations in a row with the same letters.

However, I have to say that seeing the letters in your results would probably be boring and not very informative. It's only when the letters found in your results are compared to the letters known to appear in most humans at each location that they have any meaning.

I've taken both the Y DNA STR- 67 and the Family Finder. So how can I see the lettered sequence?

[Jim Barrett]

This is just an example of what you would see for STR values for DYS385a & DYS385b. The number of times you would see the repeat of GAAA would depend on the number of repeats reported in your results for these two peaks.

DYS385a (CEPH 1358-01)
Example Sequence:
AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGA AATG
AAATTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAGAAA GAGA
AAAAGAGAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGA AAGG
AAGGAAGGAAGGAAGGAAGG/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAA
A/GAAA/GAAA/GAAA/GAAA/GAGAAAAAGAAAGGAGGACTATGTAATTGGC
11 repeats 257 bp (GAAA)11
DYS385b (CEPH 1358-01)
Example Sequence:
AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGA AATGAAA
TTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAGAAAGAG AAAAAGA
GAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGAAAGGAA GGAAGGA
AGGAAGGAAGG/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/
GAAA/GAAA/GAAA/GAAA/GAAA/GAGAAAAAGAAAGGAGGACTATGTAATTGGC
14 repeats 269 bp (GAAA)14

If you really want to see this for all of your STRs and SNPs you might start by ordering whole-genome sequencing.

[hansonrf]

Some factoids from a DNA presentation:

• Each nucleotide is composed of a nitrogen-containing nucleobase—either cytosine (C), guanine (G), adenine (A), or thymine (T)
  
• The smallest unit is called a base-pair, referred to as A, C, G, or T in results
  
• We have 3.3 BILLION base pairs in our genome; a small percentage is still a lot of DNA
  
• Most of our DNA is common and makes us human; we rely on the differences (SNPs and STRs; called markers or alleles) that are shared only among related folks for genealogy and ancestry
  
• Traditional Y-DNA looks at 12 to 111 STRs for paternal lineage (only)
  
• Y-SNPs are now used to refine STR results for nearer-term and deep ancestry; there are more than 160,000 useful Y-SNPs among the 60 Million Y- base pairs
  
• There is relatively little DNA in the mitochondria (16,600 base pairs), but all of it is useful with designated SNPs. A Full Mitochondrial Sequence (FMS) tests for all these SNPs.
  
• There are more than 2 Million SNPs on the X Chromosome but only around 15,000 are useful and tested.
  
• There are around 60 Million autosomal SNPs, but only 1 Million are considered useful and ~700,000 are common among the 3 major testers.

Good luck reviewing your entire genome...

[Biblioteque]

Am interested in the whole genome testing. What is the cost/benefit?

[Jomid59]

Know nothing about this company, but they do appear to offer full genome sequencing for only $999.

veritasgenetics link removed

Actually thinking about this so any feedback would be appreciated.

[KATM]

Hi,

I have seen that our DNA sequence comes in the form of repeating letters. How can we see our sequence in our results?

Thanks

I checked my records, because I thought I had seen a file with a "block" of the repeating letters you describe.

The only file that I have downloaded, from tests done at 23andMe, Geno 2.0, and FTDNA (Family Finder and mtDNA full sequence) that has the repeating letters is the FASTA file(in text format) from the mtDNA full sequence. All downloads from the other testing are .csv or .xml files, and show SNPs listed, with the two alleles shown (AA, AT, etc.).

[hansonrf]

http://now.howstuffworks.com/2016/04/06/is-knowing-your-full-genome-a-right-a-privilege?__hstc=71491980.84f9077cce7ba1c32f7b72dedd655b24.1460552564265.1460552564265.1460552564265.1&__hssc=71491980.10.1460552564265&__hsfp=13057700

(Referenced on their web site)

This says it is (was) pre-order only (as of April 6, 2016), and raises the FDA issue that shut 23andMe down as a hurdle yet to be addressed.

FTDNA has (had) about the best error/no-call rate of anyone at between 0.5 and 1.0 %. I wonder what these guys will get or guarantee.

$999 is an awesome price. Too good? A catch?

[Biblioteque]

In my notes, I have the following costs of sequencing the human genome in prior years:

In dollars:
2001 - 2.7 billion
2007 - 1 million
2009 - 4,400
2013 - 1,000

Wow! What a deal.

P.S. Hopefully, someone here at the forum will tell us the benefits to be derived from testing.

[GregR1]

This is just an example of what you would see for STR values for DYS385a & DYS385b. The number of times you would see the repeat of GAAA would depend on the number of repeats reported in your results for these two peaks.

DYS385a (CEPH 1358-01)
Example Sequence:
AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGA AATG
AAATTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAGAAA GAGA
AAAAGAGAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGA AAGG
AAGGAAGGAAGGAAGGAAGG/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAA
A/GAAA/GAAA/GAAA/GAAA/GAGAAAAAGAAAGGAGGACTATGTAATTGGC
11 repeats 257 bp (GAAA)11
DYS385b (CEPH 1358-01)
Example Sequence:
AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGA AATGAAA
TTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAGAAAGAG AAAAAGA
GAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGAAAGGAA GGAAGGA
AGGAAGGAAGG/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/
GAAA/GAAA/GAAA/GAAA/GAAA/GAGAAAAAGAAAGGAGGACTATGTAATTGGC
14 repeats 269 bp (GAAA)14

If you really want to see this for all of your STRs and SNPs you might start by ordering whole-genome sequencing.

Yes my 67 repeats are, 12 -11-13-11-11-13-12.

So there's no way I can see the corresponding letters with out a full genome test?

[Darren]

The NIST will show you the repeated motif for various markers. So if your allele value is 12 you would have 12 repeats of the motif shown.

http://www.cstl.nist.gov/strbase/ystr_fact.htm

-Darren
Family Tree DNA