shared CM higher than parent.

[mmierzwa]

I have a question. How does one get more of a DNA match with someone than a parent does?
I have a match, who with me shows a shared CM: 58.75 and a relationship Range of 2-4th.
My mom agreed to test and she also matches this person, but with a Shared CM: 43.24 and a relationship range of 3-5th.

How does this happen? Shouldn’t this be in reverse?
Regards,
Mike

[madman]

It means you got some from your father

I have a question. How does one get more of a DNA match with someone than a parent does?
I have a match, who with me shows a shared CM: 58.75 and a relationship Range of 2-4th.
My mom agreed to test and she also matches this person, but with a Shared CM: 43.24 and a relationship range of 3-5th.

How does this happen? Shouldn’t this be in reverse?
Regards,
Mike

[prairielad]

or due to a combination of your maternal and paternal chromosome values, matching algorithm is creating a small false match at one end or the other of your matching segment(or at both ends) by picking values from both.

ie
Red False matching, Blue Actual segment.
maternal chromosome value
AACTGGATGCTTTGCCATGGTAAGCTAATG
paternal chromosome value
GCTGTCATGTTACCGATTCATGGCTAAGAC

Matching segment
GATGGGATGCTTTGCCATGGTAAGCTAGTC

[mmierzwa]

I wonder now then if this is a match on both sides.
From what I know, the matches’ grandparents, one came from an area where my father’s family came from in Poland.
And one grandparent came from where my mother’s mother came from in Poland.
Those areas are on the opposite side of Poland!
It would be an interesting match indeed if we can figure it out. Matching both sides of my family? That’s lotto odds!