Go Back   Family Tree DNA Forums > General Interest > The Genographic Project

The Genographic Project Do you have results from Genographic? Are you considering testing with them? This board is open to customers and visitors.

Reply
 
Thread Tools Display Modes
  #1  
Old 5th January 2013, 04:33 AM
rdbox26hs rdbox26hs is offline
FTDNA Customer
 
Join Date: Feb 2012
Posts: 55
Probably a stupid question about ydna H subclades

I just got my Geno 2.0 kit results yesterday and uploaded them to ftdna. Ftdna is still showing me as H1a/H-m82, but Geno 2.0 now has me as H1/H-m52.

I knew there was some relayering in R1b and J2, but how should I understand these new H results.
Reply With Quote
  #2  
Old 6th January 2013, 09:45 AM
tomcat tomcat is offline
FTDNA Customer
 
Join Date: May 2005
Location: Jamaica Plain, MA
Posts: 3,397
I think that is a question best directed to FTDNA or your Y project admin.

Geno tests many more Y SNP's than FTDNA's Deep Clade, so Geno may be more accurate. The discrepancy also could arise if FTDNA and Geno are referencing different builds of the Y tree.

Is m82 downstream of m52?
Reply With Quote
  #3  
Old 6th January 2013, 10:12 AM
MMaddi MMaddi is offline
yDNA: R-CTS2509; mtDNA: T2e
 
Join Date: Jul 2005
Location: Houston, TX
Posts: 3,376
According to ISOGG's tree for H - at http://www.isogg.org/tree/ISOGG_HapgrpH.html - M82 is downstream from M52. So, FTDNA's designation of H1a is deeper than Geno 2.0's H1.

It's possible that M82 is not included on the Geno 2.0 chip, so they didn't test you for that. You can check your raw data and see if M82 is on the chip or not.
Reply With Quote
  #4  
Old 6th January 2013, 02:47 PM
ScooterCat ScooterCat is offline
Registered User
 
Join Date: Oct 2012
Location: Jax, FL, USA
Posts: 171
M82 is tested in Geno 2.0. Possibly a no call?
Reply With Quote
  #5  
Old 6th January 2013, 03:48 PM
MMaddi MMaddi is offline
yDNA: R-CTS2509; mtDNA: T2e
 
Join Date: Jul 2005
Location: Houston, TX
Posts: 3,376
Quote:
Originally Posted by ScooterCat View Post
M82 is tested in Geno 2.0. Possibly a no call?
I think a no call would be indicated by "-." What does your raw data file have as the result for M82?
Reply With Quote
  #6  
Old 6th January 2013, 04:21 PM
rdbox26hs rdbox26hs is offline
FTDNA Customer
 
Join Date: Feb 2012
Posts: 55
Quote:
Originally Posted by MMaddi View Post
I think a no call would be indicated by "-." What does your raw data file have as the result for M82?
The Raw Data File, CSV, has me at M82 as D, both in Allele 1 & 2.

FTDNA in SNPs says I am m82+.

I have not found any information online about the re-layering of y-dna H, unlike several other Haplogroups. This is basically what is confusing me about my terminal SNP.
Reply With Quote
  #7  
Old 6th January 2013, 04:48 PM
MMaddi MMaddi is offline
yDNA: R-CTS2509; mtDNA: T2e
 
Join Date: Jul 2005
Location: Houston, TX
Posts: 3,376
Quote:
Originally Posted by rdbox26hs View Post
The Raw Data File, CSV, has me at M82 as D, both in Allele 1 & 2.

FTDNA in SNPs says I am m82+.

I have not found any information online about the re-layering of y-dna H, unlike several other Haplogroups. This is basically what is confusing me about my terminal SNP.
I would trust FTDNA's call for M82 over Geno 2.0's call. FTDNA uses direct sequencing in their SNP testing and Geno 2.0 uses chip technology. Direct sequencing is regarded as more accurate.
Reply With Quote
  #8  
Old 6th January 2013, 05:51 PM
ScooterCat ScooterCat is offline
Registered User
 
Join Date: Oct 2012
Location: Jax, FL, USA
Posts: 171
Quote:
Originally Posted by rdbox26hs View Post
The Raw Data File, CSV, has me at M82 as D, both in Allele 1 & 2.

FTDNA in SNPs says I am m82+.
...
D (delete) is the derived form, so Geno 2.0 is showing you as M82+ also, and should be showing your haplogroup as H1a.

From ymap:
ChrY M snp 20353562 20353562 . + . ID=M82;
allele_anc=ins;
allele_der=del;
primer_f=CTGTACTCCTGGGTAGCCTGT;
primer_r=AAGAACGATTGAACACACTAACTC;
YCC_haplogroup=H1a;
ISOGG_haplogroup=H1a;
Mutation=-2bp;
count_tested=656;
count_derived=53;
comments=B9.t18
Reply With Quote
  #9  
Old 10th January 2013, 12:02 PM
Donald Locke Donald Locke is offline
FTDNA Customer
 
Join Date: Nov 2004
Posts: 347
rdbox26hs, I presume you are a participant in the Y Haplo H project?

If you are who I think you are, FTDNA shows you in Y Haplo Group H1a - M82, and if you are the right participant that I am looking at, you have also been Deep Clade SNP tested with FTDNA and confirmed H1a, is that correct?

If that is the case that you have been Y DNA tested to the 67 marker level and also been Deep Clade SNP tested H1a - M82, then the Geno 2.0 isn't up to speed on Haplo H* if it is only showing you in H1.

I had hoped the Geno 2.0 test would dig deeper in to us H* men, but it seems FTDNA is more on the ball then Geno 2 when it comes to the H* men.
Reply With Quote
  #10  
Old 10th January 2013, 12:04 PM
Donald Locke Donald Locke is offline
FTDNA Customer
 
Join Date: Nov 2004
Posts: 347
According to one Indian / Romany DNA study published recently, that team has identified a deeper downstream of H*, which they identifiy that downstream SNP as H1a1a, and I had high hopes the Geno 2 test would be able to identify anyone in the downstream SNP, but if Geno 2 is only telling you H1 then it appears Geno 2 isn't looking at the H* downstream SNP's yet.

Last edited by Donald Locke; 10th January 2013 at 12:07 PM.
Reply With Quote
Reply

Bookmarks


Currently Active Users Viewing This Thread: 1 (0 members and 1 guests)
 
Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

Forum Jump


All times are GMT -5. The time now is 06:36 AM.


Family Tree DNA - World Headquarters

1445 North Loop West, Suite 820
Houston, Texas 77008, USA

Phone: (713) 868-1438 | Fax: (832) 201-7147
Copyright 2001-2010 Genealogy by Genetics, Ltd.
Powered by vBulletin® Version 3.8.4
Copyright ©2000 - 2017, Jelsoft Enterprises Ltd.