Haplogroup V?

[Tereze]

My apologies in advance for what I am now posting. I have just been diagnosed with a devestating disease, MDS, and a bone marrow transplant may be my best option. My doctor is starting the process of searching registries, but he seemed to think there might indeed be a better chance of finding a match in people of the same haplogroup.

My mitochondrial DNA is haplogroup V. If you share this haplogroup with me - and the idea of being my savior appeals to you ! - you can go to a website called Be the Match and register with them. And donation technology is now like giving blood, not surgical or like a marrow biopsy... so don’t be scared!!

I’m sure this is a rather ‘nervy’ plea, and again, I mean no offense, and if I have offended, please forgive me!

Thank you.

[khazaria]

Bone marrow transplants depend on matching people who share the same HLA types on chromosome 6 in positions between 25 million and 33 million. That is autosomal DNA. It has nothing to do with matching mtDNA haplogroups, as far as I know, even though Myelodysplastic syndrome does include "the loss of mitochondrial function over time" according to Wikipedia, and may be partly caused by deleterious mtDNA mutations.

The autosomal DNA test, Family Finder, will indicate some people who share the same stretches of gene settings in the HLA region of chromosome 6 that you have. If at least 4 matches triangulate with each other in that area (this can be confirmed by asking them or by checking at GEDmatch or MyHeritageDNA), you share a common ancestor with them on one side of your chromosome. You will have additional HLA settings on your chromosome's other side and a different common ancestor with matches to that. A particular ethnicity may be indicated by the matches' backgrounds. For example, one side of my HLA is of Sephardic Jewish origin and the other side is of Polish origin and both sides also are found among some Ashkenazic Jews so if somebody sharing my HLA haplotypes needed a bone marrow transplant they would find suitable matches among those 3 populations.

[khazaria]

Amendment to my earlier message:
The HLA region begins at 29 million, not 25 million.

[Tereze]

Haplogroup V

khazaria, (love the name!) thanks so much for this immensely informative post. Now I just have to understand it sufficiently to translate into action! But it does sound as if it might be worth it to try and trace ancestry. My fathers mitochondrial DNA was haplogroup T, which is more common than V. I joined this site 7 years ago when they only looked at mtDNA...

Can you suggest how I might best go about tracking possible matches? I had my cousin on my fathers side do the mtDNA test so I’d have to access his results to find matches. And it seems I can’t contact individual matches. You are clearly very knowledgeable, any further help would be deeply appreciated.

Thanks again,
Tereze

[khazaria]

Tereze,

1. Purchase a Family Finder autosomal DNA swab test for yourself. Fortunately, it costs a lot less money than the mtDNA test. You will have direct access to your account and if you wish you can also designate a second email recipient and a beneficiary.

2. After your Family Finder results come in, go into the Chromosome Browser screen and download all matches' locations as a spreadsheet. This is the file with all start and stop positions between your matches and you across all chromosomes.

3. Browse through the spreadsheet to look who shares at least the entire area on chromosome 6 between 29 million and 33 million with you. They will match you there at a minimum of 4 or 5 centimorgans (cM) but closer cousins will have centimorgan lengths longer than that. Longer is better. You have two sides to your chromosome 6 browser so you will have two clusters of matches who are relevant.

4. You can contact those people by email by looking at their Family Finder profiles. These people are very likely to share your exact Human Leukocyte Antigen (HLA) haplotypes because they share the same common ancestors as you across the relevant part of your DNA. Most of them will be your 14th cousins or closer. There are ways to confirm that these are your real cousins using triangulation inside GEDmatch.com. Genuine matches across this part of chromosome 6 have especially high SNP counts since many of its genes are tested.

5. While HLA allele/haplotype values cannot be looked up using Family Finder data in the HLA format that immunologists and bone marrow specialists use with patients and donors, your genetic settings can be downloaded in the form of the raw data file, showing "rs" followed by a sequence of numbers for each gene location and letters like AG as the gene settings. These should match up closely with the gene settings of your matches in the relevant area. If you have a location called rs387273 and your value is TC, your matches from one side of your chromosome will also have the T, and your matches on the other side will also have C, most of the time, except for chance mutations here and there. Your true cousin matches have a string of values identical to yours, such as CTAATAAAGGGTTTTAAAGTTAAA etc.

From Be The Match:

"A close match between a donor’s and a patient’s HLA markers is essential for a successful transplant outcome."

"Research shows that patients have better outcomes (results) with a closely matched donor. Sometimes doctors want to match 8 HLA markers. Other times, doctors want to match 10 markers."

"You’re more likely to match someone with a similar ethnic background or ancestry."

[Tereze]

Haplogroup V

Again, my deepest thanks. I will try to follow your instructions, and I am so grateful to you for taking the time to provide me with so much detail. At the moment I’m rather a deer in the headlights - stunned, and every day dealing with more symptoms. But you’ve given me a road map. So immensely kind - I thank you.